Occurrence record: 8549b372-c72b-4056-a0bb-99e476cc2477

Material Sample of Glaucosoma hebraicum Richardson, 1845 | West Australian Dhufish recorded on 2012-02-21

API

Dataset

Data resource	Location and transport of early life stages of West Australian Dhufish, Glaucosoma hebraicum.
Record type	Material Sample Supplied basis "MaterialSample"
License	CC-BY 4.0 (Int)
Associated references	https://publications.csiro.au/rpr/pub?pid=csiro:EP126910
Presence/Absence	PRESENT Supplied as present

Event

Occurrence date	2012-02-21 Supplied date "21/02/2012"
Sampling protocol	50cm diamter bongo net tow 355 micron mesh
End day of year	52
Date precision	DAY
Start day of year	52

Taxonomy

Scientific name	Glaucosoma hebraicum
Identified to rank	species
Common name	West Australian Dhufish
Kingdom	Animalia
Phylum	Chordata
Class	Actinopterygii
Order	Perciformes
Family	Glaucosomatidae
Genus	Glaucosoma
Species	Glaucosoma hebraicum
Name match metric	exactMatch
Scientific name authorship	Richardson, 1845
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	Western Australia
Locality	Australia, West Australia, Cape Naturaliste, Cape Leeuwin and Perth
Habitat	Supplied as "Temperate marine"
Latitude	-34.2442 Supplied as: "-34.2442"
Longitude	114.9852 Supplied as: "114.9852"
Datum	EPSG:4326
Coordinate precision	Unknown
Terrestrial	true
Biome	TERRESTRIAL
Marine	false
Country Code	AU
Depth	36.6

Additional properties

alt elev	sea level
biotic relationship	environmental
collection date	January-March, 2012
data type comment	You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/
env biome	Temperate marine
env feature	ocean
env material	seawater, plankton tow
experimental factor	environmental DNA survey
geo loc name	Australia, West Australia, Cape Naturaliste, Cape Leeuwin and Perth
investigation type	survey, eukaryotes, larval fish
lat lon	34.14.65,114.59.11
nucl acid ext	Qiagen Dneasy Blood & Tissue Kit
pcr cond	94�C 2 minutes, (94�C 30 seconds, 58�C 20 s, 72�C 30 s) x 35, 72�C 1 minute.
pcr primers	Ghebcox1_540F AACTCCTCTGTTCGTATGGGCGGTA, Ghebcox1_666R AAAGAATGGGGTCCCCTCCTCCGGAT, Fish16s_1160F ACGAGAAGACCCTATGGAG, Fish16s_1415R CTGTTATCCCTAGGGTAAC
project name	Detecting the planktonic eggs and larvae of harvested species in near real-time: DNA-based detection of West Australian dhufish (Glaucosoma hebraicum)
samp collect device	Bongo Net, 50cm diameter, 355 micron mesh
samp mat process	Oblique Bongo tow
submitted to insdc	Dryad Digital Repository
target gene	Cytochrome oxidase subunit 1, 16S rRNA

User flagged issues

Data quality tests

Test name	Result
Coordinate uncertainty meters invalid	Warning
Country inferred from coordinates	Warning
Geodetic datum assumed WGS84	Warning
Show/Hide 78 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinates dont match supplied country	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Name not supplied	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 36 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Modified date invalid	Unchecked (lack of data)
Modified date unlikely	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Additional political boundaries information

Area Management
Australian Coral Ecoregions	SW West Australia
CAPAD 2016 Marine	Ngari Capes
CAPAD 2020 Marine	Ngari Capes
CAPAD 2022 - Marine (Collaborative Australian Protected Areas Database)	Ngari Capes
IMCRA v4.0 Meso-Scale Bioregions (Integrated Marine and Coastal Regionalisation of Australia)	Leeuwin-Naturaliste
IMCRA v4.0 Provincial Bioregions (Integrated Marine and Coastal Regionalisation of Australia)	Southwest Shelf Province
NRM Regions	South West
NRM Regions 2017	South West Region
National Landcare Program Management Units 2018	South West Region
Natural Resource Management (NRM) Regions 2023	South West Region
Biodiversity
IMCRA 4 Regions	Southwest Shelf Province
Indigenous
Indigenous Land Use Agreements	South West Boojarah #2 Indigenous Land Use Agreement
RATSIB (representative Aboriginal/Torres Strait Islander body) Areas 2024	South West
Marine
IMCRA4 Mesoscale Bioregions	Leeuwin-Naturaliste
States including coastal waters	Western Australia (including Coastal Waters)
Local Government Areas PSMA 2018	SHIRE OF AUGUSTA-MARGARET RIVER

Group	Field Name	Original Value	Processed Value


Classification	Scientific name	Glaucosoma hebraicum	Glaucosoma hebraicum
	Match type		exactMatch
	Phylum id		https://biodiversity.org.au/afd/taxa/065f1da4-53cd-40b8-a396-80fa5c74dedd
	Family id		https://biodiversity.org.au/afd/taxa/8fb70655-45bb-44ab-89be-0e9576eb782d
	Taxon concept ID		https://biodiversity.org.au/afd/taxa/56fb1ee1-cbae-4942-9b40-38762c6ccf86
	Order		Perciformes
	Taxon rank id		7000
	Species id		https://biodiversity.org.au/afd/taxa/56fb1ee1-cbae-4942-9b40-38762c6ccf86
	Genus		Glaucosoma
	Left		44660
	Scientific name authorship		Richardson, 1845
	Taxon rank		species
	Genus id		https://biodiversity.org.au/afd/taxa/338a2bc0-3cec-4253-a86b-4fc9e5227add
	Name type		SCIENTIFIC
	Vernacular name		West Australian Dhufish
	Order id		https://biodiversity.org.au/afd/taxa/e3fda0ff-4705-4a40-8991-1dfabdadcfae
	Right		44660
	Kingdom		Animalia
	Class id		https://biodiversity.org.au/afd/taxa/83e82cc3-be4e-40e8-9e7a-985737c4f726
	Phylum		Chordata
	Class		Actinopterygii
	Species		Glaucosoma hebraicum
	Family		Glaucosomatidae
	Kingdom id		https://biodiversity.org.au/afd/taxa/4647863b-760d-4b59-aaa1-502c8cdf8d3c
Event	Year		2012
	End day of year		52
	Month		2
	Date precision		DAY
	Start day of year		52
	Day		21
	Event date	21/02/2012	2012-02-21
Occurrence	Associated references	https://publications.csiro.au/rpr/pub?pid=csiro:EP126910
	Occurrence status	present	PRESENT
	Basis of record	MaterialSample	MATERIAL_SAMPLE
	Sampling protocol	[50cm diamter bongo net tow 355 micron mesh]
Attribution	Data resource		Location and transport of early life stages of West Australian Dhufish, Glaucosoma hebraicum.
	License		CC-BY 4.0 (Int)
	Data Resource ID	dr8131	dr8131
Location	Country		Australia
	Habitat	Temperate marine
	Decimal latitude	-34.2442	-34.2442
	Terrestrial	true	true
	Locality	Australia, West Australia, Cape Naturaliste, Cape Leeuwin and Perth	Australia, West Australia, Cape Naturaliste, Cape Leeuwin and Perth
	Decimal longitude	114.9852	114.9852
	State province		Western Australia
	Biome		TERRESTRIAL
	Marine	false	false
	Country code		AU
	Geodetic datum		EPSG:4326
	Verbatim depth	36.6