Occurrence record: BOLD - Australian records - 3508072

Material Sample of NEUROPTERA | Ant-lions recorded on 2009-04-20

API

Dataset

Data partner	Barcode of Life
Data resource	BOLD - Australian records
Catalog number	3508072
Other catalog numbers	["recordID:1371660","ProcessID:NRAS101-10","sampleID:09TASF-0641"]
Record type	Material Sample Supplied basis "MaterialSample"
Collector	Bob Ward
Reproductive condition	sexual
Life stage	adult
License	CC-BY-Int
Field Number	TASF-200409
Type	PhysicalObject
Presence/Absence	PRESENT

Event

Field Number	TASF-200409
Occurrence date	2009-04-20
End day of year	110
Date precision	DAY
Start day of year	110

Taxonomy

Scientific name	NEUROPTERA
Identified to rank	order
Common name	Ant-lions
Kingdom	Animalia
Phylum	Arthropoda
Class	Insecta
Order	Neuroptera
Name match metric	exactMatch
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	Tasmania
Latitude	-42.986 Supplied as: "-42.986"
Longitude	147.317 Supplied as: "147.317"
Datum	EPSG:4326
Coordinate precision	Unknown
Terrestrial	true
Biome	TERRESTRIAL
Marine	false
Country Code	AU

Additional properties

genbank accession	HM380341
markercode	COI-5P
nucleotides	TACTTTATATTTCATTTTTGGAATTTGATCTGGATTAGTAGGTACAAGTTTAAGTTTATTAATTCGAGCTGAATTAGGTCAACCAGGTTCATTAATTGGTGATGATCAAGTTTATAATGTTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCTATTGTAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATATTAGCTGCACCCGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCTTTAACACTGCTCCTAGCTTCATCTATAGTAGAAAGAGGGGCTGGAACAGGATGAACTGTATACCCACCTCTTTCATCTAGAATTGCTCATGCAGGAGCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAGCTGGAATTTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACAGTAATTAATATACGATTAAGTTACATAACTTTAGATCGAATACCTTTATTTGTTTGATCTGTTGTTATTACAGCTTTATTACTTTTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Owner institution code	Biodiversity Institute of Ontario
sequence last updated	2011-11-14T08:11:46Z

User flagged issues

Data quality tests

Test name	Result
Coordinate uncertainty meters invalid	Warning
Geodetic datum assumed WGS84	Warning
Name not supplied	Warning
Show/Hide 80 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinates dont match supplied country	Passed
Country inferred from coordinates	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Modified date invalid	Passed
Modified date unlikely	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 34 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Additional political boundaries information

Area Management
IBRA (Interim Biogeographic Regionalisation for Australia (IBRA) Version 7 (Regions)	Tasmanian South East
IBRA (Interim Biogeographic Regionalisation for Australia (IBRA) Version 7 (Subregions), contextual (polygon)	South East
IBRA7 subregions	South East
NRM Regions	South
NRM Regions 2017	South NRM Region
National Landcare Program Management Units 2018	South NRM Region
Natural Resource Management (NRM) Regions 2023	South NRM Region
Biodiversity
IBRA 6 Regions	Tasmanian South East
IBRA 7 Regions	Tasmanian South East
Hydrology
Australian Drainage Divisions 2021	Tasmania
Australian Drainage Divisions Level 1	Tasmania
Drainage Divisions Level 2	KINGSTON COAST
Indigenous
Indigenous Areas	KINGBOROUGH
Indigenous Areas 2021	Kingborough
Indigenous Locations	KINGBOROUGH
Indigenous Locations 2021	Kingborough
Indigenous Regions	TASMANIA
Indigenous Regions 2021	Tasmania
RATSIB (representative Aboriginal/Torres Strait Islander body) Areas 2024	Tasmania
Land Management
Remoteness Areas	Inner Regional Australia
Marine
States including coastal waters	Tasmania (including Coastal Waters)
Political
ASGS Australian States and Territories	Tasmania
Australian States and Territories	Tasmania
Commonwealth Electoral Divisions 2021	Franklin
LGA Boundaries (deprecated)	Kingborough
Local Government Areas	Kingborough (M)
Local Government Areas PSMA 2018	KINGBOROUGH COUNCIL
PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016)	10
PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016)	1297
PSMA Commonwealth Electoral Boundaries (2018)	FRANKLIN
PSMA State Electoral Boundaries (2018)	NELSON
PSMA States (2016)	TASMANIA
State Electoral Divisions 2022	Franklin (Nelson)
World Country Boundaries	Australia
Social
Australia 2021	Australia
Destination Zones 2021	Kingston Beach - Blackmans Bay
Greater Capital City Statistical Areas	GREATER HOBART
Greater Capital City Statistical Areas 2021	Greater Hobart
Local Government Areas 2023	Kingborough
Postal Areas 2021	7050
Remoteness Areas 2021	Inner Regional Australia
States and Territories 2021	Tasmania
Statistical Areas Level 2	KINGSTON BEACH - BLACKMANS BAY
Statistical Areas Level 2	Kingston Beach - Blackmans Bay
Statistical Areas Level 3	HOBART - SOUTH AND WEST
Statistical Areas Level 3	Hobart - South and West
Statistical Areas Level 4	HOBART
Statistical Areas Level 4	Hobart
Tourism Regions 2021	Hobart and the South
Vegetation
Forests of Australia	Non Forest
Vegetation types - native	Eucalypt open forests
Vegetation types - present	Eucalyptus open forest

Environmental sampling for this location

Climate
Annual Mean Moisture Index (Bioclim 28) from 1976-2005 at 9s / 250m resolution	0.77 Index
Annual Mean Radiation (Bioclim 20) from 1976-2005 at 9s / 250m resolution	13.4 Watts per meter squared (W/m2)
Annual Mean Temperature (Bioclim 01) from 1976-2005 at 9s / 250m resolution	12.1 degrees C
Annual Temperature Range (Bioclim 07) from 1976-2005 at 9s / 250m resolution	17.9 degrees C
Annual Total Precipitation (Bioclim 12) from 1976-2005 at 9s / 250m resolution	687.0 mm
Isothermality (Bioclim 03) from 1976-2005 at 9s / 250m resolution	0.51
Maximum Temperature of Warmest Month (Bioclim 05) from 1976-2005 at 9s / 250m resolution	21.7 degrees C
Mean Diurnal Range (Bioclim 02) from 1976-2005 at 9s / 250m resolution	9.1 degrees C
Mean Moisture Index of Wettest Quarter (Bioclim 32) from 1976-2005 at 9s / 250m resolution	1.0 Index
Mean Temperature of Coldest Quarter (Bioclim 11) from 1976-2005 at 9s / 250m resolution	8.3 degrees C
Mean Temperature of Driest Quarter (Bioclim 09) from 1976-2005 at 9s / 250m resolution	11.4 degrees C
Mean Temperature of Warmest Quarter (Bioclim 10) from 1976-2005 at 9s / 250m resolution	15.9 degrees C
Mean Temperature of Wettest Quarter (Bioclim 08) from 1976-2005 at 9s / 250m resolution	9.8 degrees C
Minimum Temperature of Coldest Month (Bioclim 06) from 1976-2005 at 9s / 250m resolution	3.8 degrees C
Precipitation Seasonality (Coefficient of Variation) (Bioclim 15) from 1976-2005 at 9s / 250m resolution	15.0 percent (%)
Precipitation of Coldest Quarter (Bioclim 19) from 1976-2005 at 9s / 250m resolution	180.0 mm
Precipitation of Driest Quarter (Bioclim 17) from 1976-2005 at 9s / 250m resolution	146.0 mm
Precipitation of Warmest Quarter (Bioclim 18) from 1976-2005 at 9s / 250m resolution	157.0 mm
Precipitation of Wettest Quarter (Bioclim 16) from 1976-2005 at 9s / 250m resolution	201.0 mm
Precipitation of the Driest Month (Bioclim 14) from 1976-2005 at 9s / 250m resolution	10.0 mm
Precipitation of the Wettest Month (Bioclim 13) from 1976-2005 at 9s / 250m resolution	17.0 mm
Radiation Seasonality (Bioclim 23) from 1976-2005 at 9s / 250m resolution	48.0 percent (%)
Radiation of Warmest Quarter (Bioclim 26) from 1976-2005 at 9s / 250m resolution	20.3 Watts per meter squared (W/m2)
Temperature Seasonality (Bioclim 04) from 1976-2005 at 9s / 250m resolution	1.03 percent (%)
WorldClim 2.1: Precipitation - annual	701.0 mm
WorldClim 2.1: Precipitation - coldest quarter	184.0 mm
WorldClim 2.1: Precipitation - driest month	48.0 mm
WorldClim 2.1: Precipitation - driest quarter	151.0 mm
WorldClim 2.1: Precipitation - seasonality	14.235075 mm
WorldClim 2.1: Precipitation - warmest quarter	156.0 mm
WorldClim 2.1: Precipitation - wettest month	70.0 mm
WorldClim 2.1: Precipitation - wettest quarter	201.0 mm
WorldClim: Temperature - isothermality	51.0 %
Elevation	33.0 m

Group	Field Name	Original Value	Processed Value


Classification	Scientific name		NEUROPTERA
	Match type		exactMatch
	Phylum id		https://biodiversity.org.au/afd/taxa/ec21b060-78e8-4a37-9e62-b8bef532b001
	Taxon concept ID		https://biodiversity.org.au/afd/taxa/09538633-25f2-4d7b-bfbc-5f01aae1ba4f
	Order	Neuroptera	Neuroptera
	Taxon rank id		4000
	Left		182779
	Taxon rank		order
	Name type		SCIENTIFIC
	Vernacular name		Ant-lions
	Order id		https://biodiversity.org.au/afd/taxa/09538633-25f2-4d7b-bfbc-5f01aae1ba4f
	Right		184285
	Kingdom		Animalia
	Class id		https://biodiversity.org.au/afd/taxa/17c9fd64-3c07-4df5-a33d-eda1e065e99f
	Phylum	Arthropoda	Arthropoda
	Class		Insecta
	Kingdom id		https://biodiversity.org.au/afd/taxa/4647863b-760d-4b59-aaa1-502c8cdf8d3c
Event	Year		2009
	End day of year		110
	Month		4
	Date precision		DAY
	Start day of year		110
	Day		20
	Event date	2009-04-20	2009-04-20
Occurrence	Field number	TASF-200409
	Type		PhysicalObject
	Catalog number	3508072
	Occurrence status		PRESENT
	Basis of record	MaterialSample	MATERIAL_SAMPLE
	Modified	2011-11-14T08:11:46Z	2011-11-14T08:11:46Z
	Reproductive condition	sexual
	Recorded by	Bob Ward
	Other catalog numbers	[recordID:1371660, ProcessID:NRAS101-10, sampleID:09TASF-0641]
	Life stage	adult	{"concept": "Adult", "lineage": ["Adult"]}
Attribution	Data resource		BOLD - Australian records
	License		CC-BY-Int
	Data provider uid		dp35
	Provenance		Published dataset
	Data Resource ID	dr375	dr375
	Data partner		Barcode of Life
Location	Country	Australia	Australia
	Decimal latitude	-42.986	-42.986
	Terrestrial	true	true
	Decimal longitude	147.317	147.317
	State province	Tasmania	Tasmania
	Biome		TERRESTRIAL
	Lga	Kingborough (M)
	Marine	false	false
	Country code		AU
	Geodetic datum		EPSG:4326