Occurrence record: ec5767c1-bbcc-45b9-9ebc-225414314cb7
Dataset
Data resource | Location and transport of early life stages of West Australian Dhufish, Glaucosoma hebraicum. |
Record type |
Material Sample
Supplied basis "MaterialSample" |
License | CC-BY 4.0 (Int) |
Associated references | https://publications.csiro.au/rpr/pub?pid=csiro:EP126910 |
Presence/Absence | ABSENT Supplied as absent |
Event
Occurrence date |
2011-12-18
Supplied date "18/12/2011" |
Sampling protocol | 50cm diamter bongo net tow 355 micron mesh |
End day of year | 352 |
Date precision | DAY |
Start day of year | 352 |
Taxonomy
Scientific name | Glaucosoma hebraicum |
Identified to rank | species |
Common name | West Australian Dhufish |
Kingdom | Animalia |
Phylum | Chordata |
Class | Actinopterygii |
Order | Perciformes |
Family | Glaucosomatidae |
Genus | Glaucosoma |
Species | Glaucosoma hebraicum |
Name match metric | exactMatch |
Scientific name authorship | Richardson, 1845 |
Name parse type | SCIENTIFIC |
Geospatial
Country | Australia |
State or Territory | Western Australia |
Locality | Australia, West Australia, Cape Naturaliste, Cape Leeuwin and Perth |
Habitat |
Supplied as "Temperate marine" |
Latitude |
-33.5315 Supplied as: "-33.5315" |
Longitude |
114.9852 Supplied as: "114.9852" |
Datum | EPSG:4326 |
Coordinate precision | Unknown |
Terrestrial | true |
Biome | TERRESTRIAL |
Marine | false |
Country Code | AU |
Additional properties
alt elev | sea level |
biotic relationship | environmental |
collection date | January-March, 2012 |
data type comment | You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/ |
env biome | Temperate marine |
env feature | ocean |
env material | seawater, plankton tow |
experimental factor | environmental DNA survey |
geo loc name | Australia, West Australia, Cape Naturaliste, Cape Leeuwin and Perth |
investigation type | survey, eukaryotes, larval fish |
lat lon | 33.31.8946,114.59.1141 |
nucl acid ext | Qiagen Dneasy Blood & Tissue Kit |
pcr cond | 94�C 2 minutes, (94�C 30 seconds, 58�C 20 s, 72�C 30 s) x 35, 72�C 1 minute. |
pcr primers | Ghebcox1_540F AACTCCTCTGTTCGTATGGGCGGTA, Ghebcox1_666R AAAGAATGGGGTCCCCTCCTCCGGAT, Fish16s_1160F ACGAGAAGACCCTATGGAG, Fish16s_1415R CTGTTATCCCTAGGGTAAC |
project name | Detecting the planktonic eggs and larvae of harvested species in near real-time: DNA-based detection of West Australian dhufish (Glaucosoma hebraicum) |
samp collect device | Bongo Net, 50cm diameter, 355 micron mesh |
samp mat process | Oblique Bongo tow |
submitted to insdc | Dryad Digital Repository |
target gene | Cytochrome oxidase subunit 1, 16S rRNA |
Data quality tests
Test name | Result |
Coordinate uncertainty meters invalid | Warning |
Country inferred from coordinates | Warning |
Geodetic datum assumed WGS84 | Warning |
Show/Hide 78 passed properties | |
Show/Hide 7 missing properties | |
Show/Hide 36 tests that have not been run |