Occurrence record: Mt3

Human observation of Mobula tarapacana (Philippi, 1892) | Sicklefin Devilray recorded on 2014-02-20

API

Dataset

Data resource	DNA metabarcoding assays reveal a diverse prey assemblage for Mobula rays in the Bohol Sea, Philippines
Occurrence ID	Mt3
Record type	Human observation Supplied basis "HumanObservation"
Sex	M
Life stage	Mature
Associated Occurrence Status	Representative record
Associated occurrences	This record has 1 inferred associated occurrences For more information see Inferred associated occurrence details
Associated occurrences	gut prey specimen(s)
License	CC-BY 3.0 (Au)
Associated references	https://onlinelibrary.wiley.com/doi/full/10.1002/ece3.4858
Presence/Absence	PRESENT Supplied as present
Associated records	REPRESENTATIVE

Event

Occurrence date	2014-02-20
End day of year	51
Date precision	DAY
Start day of year	51

Taxonomy

Scientific name	Mobula tarapacana
Identified to rank	species
Common name	Sicklefin Devilray
Kingdom	Animalia
Phylum	Chordata
Class	Chondrichthyes
Order	Myliobatiformes
Family	Mobulidae
Genus	Mobula
Species	Mobula tarapacana
Name match metric	exactMatch
Scientific name authorship	(Philippi, 1892)
Name parse type	SCIENTIFIC

Geospatial

Country	Philippines
Latitude	9.430907 Supplied as: "9.430906655"
Longitude	124.806699 Supplied as: "124.8066991"
Datum	EPSG:4326
Coordinate precision	Unknown
Coordinate uncertainty (in metres)	37240.69
Terrestrial	false
Biome	MARINE
Marine	true
Country Code	PH
Footprint well known text	polygon(124.8 9.6,125.1 9.6, 125 9.42, 124.9 9.41,124.84 9.3,124.9 9.25,124.83 9.15,124.75 9.3, 124.5 9.3,124.65 9.5,124.8 9.6)

Additional properties

disc width cm	271
primers	16S Fish
reads	2539
sample gc rohner etal 2017	MT_2014-20_5
sequence	ACCTAAGTTATTTTTAAAAATTAGCTTTTTCCCTTTGGGCATAAACAATAAATTATTAATTTTTTAACTTAACTTGTTTTTGGTTGGGGCGACCAAGGGGTAAAACAAAACCCCCTTATCGAATGTGTGAAATATCACTTAAAAATTAGAGTCACATCTCTAATTAATAGAAAATCTAACGAACAATGACCCAGGAAAATTTTTATCCTGATCAATGAACCA

User flagged issues

Data quality tests

Test name	Result
Coordinate rounded	Warning
Country inferred from coordinates	Warning
Footprint WKT invalid	Warning
Geodetic datum assumed WGS84	Warning
Show/Hide 79 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate uncertainty meters invalid	Passed
Coordinates dont match supplied country	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Footprint WKT mismatch	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Name not supplied	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 34 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Modified date invalid	Unchecked (lack of data)
Modified date unlikely	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Inferred associated occurrence details

This record has been identified as the representative occurrence in a group of associated occurrences. This mean other records have been detected that seem to relate to this record and this particular record has the most detailed information on the occurrence. More information about the duplication detection methods and terminology in use is available here:

https://github.com/AtlasOfLivingAustralia/ala-dataquality/wiki/INFERRED_DUPLICATE_RECORD

Representative Record
Record UUID	77b5ece5-957e-4eb9-9451-163d8d0864b8
Data Resource
Raw Scientific Name	Mobula tarapacana
Coordinates	9.430907,124.806699
Related records
Record UUID	dafbbec5-0f6b-413b-9e2f-66e686a023d1
Data Resource
Raw Scientific Name	Mobula tarapacana
Coordinates	9.430907,124.806699

Group	Field Name	Original Value	Processed Value


Classification	Scientific name	Mobula tarapacana	Mobula tarapacana
	Match type		exactMatch
	Phylum id		https://biodiversity.org.au/afd/taxa/065f1da4-53cd-40b8-a396-80fa5c74dedd
	Family id		https://biodiversity.org.au/afd/taxa/b042d487-d566-495b-b038-b4f9eddd3488
	Taxon concept ID		https://biodiversity.org.au/afd/taxa/92ddae19-46ec-4500-99d6-c2ee344708db
	Order		Myliobatiformes
	Taxon rank id		7000
	Species id		https://biodiversity.org.au/afd/taxa/92ddae19-46ec-4500-99d6-c2ee344708db
	Genus		Mobula
	Left		37240
	Scientific name authorship		(Philippi, 1892)
	Taxon rank		species
	Genus id		https://biodiversity.org.au/afd/taxa/19931f13-0144-439f-92e0-983ed6414e41
	Name type		SCIENTIFIC
	Vernacular name		Sicklefin Devilray
	Order id		https://biodiversity.org.au/afd/taxa/b8d12179-162c-4ff7-98c5-004cc6cb6d3e
	Right		37240
	Kingdom		Animalia
	Class id		https://biodiversity.org.au/afd/taxa/6f1093ab-9b44-4a55-9066-7daa2f902093
	Phylum		Chordata
	Class		Chondrichthyes
	Species		Mobula tarapacana
	Family		Mobulidae
	Kingdom id		https://biodiversity.org.au/afd/taxa/4647863b-760d-4b59-aaa1-502c8cdf8d3c
Event	Year		2014
	End day of year		51
	Month		2
	Date precision		DAY
	Start day of year		51
	Day		20
	Event date	2014-02-20	2014-02-20
Occurrence	Associated occurrences	<a href=https://biocache.ala.org.au/occurrences/search?q=data_resource_uid:dr11663%20AND%20related_resource_id:Mt3>gut prey specimen(s)</a>	dafbbec5-0f6b-413b-9e2f-66e686a023d1
	Associated references	https://onlinelibrary.wiley.com/doi/full/10.1002/ece3.4858
	Duplication status		R
	Occurrence status	present	PRESENT
	Basis of record	HumanObservation	HUMAN_OBSERVATION
	Occurrence ID	Mt3
	Duplicate status		REPRESENTATIVE
	Sex	M	MALE
	Life stage	Mature	{"concept": "Mature", "lineage": ["Mature"]}
Attribution	Data resource		DNA metabarcoding assays reveal a diverse prey assemblage for Mobula rays in the Bohol Sea, Philippines
	License		CC-BY 3.0 (Au)
	Provenance		Published dataset
	Data Resource ID	dr11663	dr11663
Location	Country		Philippines
	Decimal latitude	9.430906655	9.430907
	Terrestrial	false	false
	Decimal longitude	124.8066991	124.806699
	Biome		MARINE
	Coordinate uncertainty in meters	37240.69	37240.69
	Marine	true	true
	Country code		PH
	Footprint well known text	polygon(124.8 9.6,125.1 9.6, 125 9.42, 124.9 9.41,124.84 9.3,124.9 9.25,124.83 9.15,124.75 9.3, 124.5 9.3,124.65 9.5,124.8 9.6)
	Geodetic datum		EPSG:4326