Occurrence record: BIN139

Material Sample of Pseudogramma polyacanthus (Bleeker, 1856) | Honeycomb Podge recorded on 2017-10-07

API

Dataset

Data resource	Maximising fish detection with eDNA metabarcoding
Occurrence ID	BIN139
Record type	Material Sample Supplied basis "MaterialSample"
Associated Occurrence Status	Associated record
Associated occurrences	The occurrence is associated with a representative record. For more information see Inferred associated occurrence details
License	CC-BY 3.0 (Au)
Associated references	http://dx.doi.org/10.1002/edn3.222
Presence/Absence	PRESENT Supplied as present
Associated records	ASSOCIATED

Event

Occurrence date	2017-10-07
End day of year	280
Date precision	DAY
Start day of year	280

Taxonomy

Scientific name	Pseudogramma polyacanthus Supplied scientific name "Pseudogramma polyacantha"
Identified to rank	species
Common name	Honeycomb Podge
Kingdom	Animalia
Phylum	Chordata
Class	Actinopterygii
Order	Perciformes
Family	Serranidae
Genus	Pseudogramma
Species	Pseudogramma polyacanthus
Name match metric	exactMatch
Scientific name authorship	(Bleeker, 1856)
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	Western Australia
Locality	Browse Island North
Latitude	-14.10443 Supplied as: "-14.10443"
Longitude	123.5469 Supplied as: "123.54690"
Datum	EPSG:4326
Coordinate precision	Unknown
Coordinate uncertainty (in metres)	10.0
Terrestrial	true
Elevation	Sea level
Biome	TERRESTRIAL
Marine	false
Country Code	AU
Depth	Surface

Additional properties

chimeracheck	VSEARCH
environment(biome)	Ocean
environment(feature)	Intertidal zone
environment(material)	Seawater
environment biome	Ocean
environment feature	Intertidal zone
environment material	Seawater
experimental factor	Fishes, diversity, water sample volume
geographiclocation(countryand/orsea,region)	Australia, Browse Island
geographiclocation countryand orsea region	Australia, Browse Island
investigationtype	Eukaryote
libraryconstructionmethod	Illumina single-end sequencing
nucleicacidextraction	Qiagen Dneasy Blood & Tissue Kit
pcrconditions	initial denaturation at 95�C for 5 min, followed by 40 cycles of 30 s at 95�C, 30 s at the primer annealing temperature 54�C, and 45 s at 72�C, with a final extension for 10 min at 72�C
pcrprimers	16S rDNA region (16SF/D 5? GACCCTATGGAGCTTTAGAC 3? and 16S2R - degenerate 5? CGCTGTTATCCCTADRGTAACT 3?; Berry et al. 2017, Deagle et al. 2156
primers	16S Fish
projectname	Maximising fish detection with eDNA metabarcoding
reads	297
samplecollectiondevice	Bottle
samplematerialprocessing	Filtering seawater
samplesize	20700mL
sequence	ACCAAAGCAGACCATGCATTAACCCCTACAAAGGAAATAAAGCCAAATGACCCCTGCCCTAGTGTCTTCGGTTGGGGCGACCGCGGGGAAGGGAAAAACCCCCGCACGGACCGGGGAGACTACTCCTTAAAAGCAAGAGCCACAGCTCTAACTAACAGAATTTCTGGCCAATAGATCCGGCAATGCCGATTAATGGACCA
sequencingmethod	Illumina sequencing by synthesis
data type comment	You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/
original scientific name	Pseudogramma polyacantha

User flagged issues

Data quality tests

Test name	Result
Country inferred from coordinates	Warning
Geodetic datum assumed WGS84	Warning
Show/Hide 80 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinate uncertainty meters invalid	Passed
Coordinates dont match supplied country	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Missing taxon rank	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Name not supplied	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 6 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Show/Hide 36 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Modified date invalid	Unchecked (lack of data)
Modified date unlikely	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Inferred associated occurrence details

This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:

https://github.com/AtlasOfLivingAustralia/ala-dataquality/wiki/INFERRED_DUPLICATE_RECORD

Representative Record
Record UUID	5ebf027b-5d61-44bd-a423-4732ef1a7ef8
Data Resource
Raw Scientific Name	Pseudogramma polyacantha
Coordinates	-14.10443,123.5469
Related records
Record UUID	e3d91965-9f89-4da9-a7bd-9ac256564108
Data Resource	Maximising fish detection with eDNA metabarcoding
Raw Scientific Name	Pseudogramma polyacantha
Coordinates	-14.10443,123.5469

Additional political boundaries information

Area Management
Australian Coral Ecoregions	Kimberley Coast
IMCRA v4.0 Meso-Scale Bioregions (Integrated Marine and Coastal Regionalisation of Australia)	Northwest Shelf
IMCRA v4.0 Provincial Bioregions (Integrated Marine and Coastal Regionalisation of Australia)	Northwest Shelf Province
Biodiversity
IMCRA 4 Regions	Northwest Shelf Province
Indigenous
RATSIB (representative Aboriginal/Torres Strait Islander body) Areas 2024	Kimberley
Marine
IMCRA4 Mesoscale Bioregions	Northwest Shelf
States including coastal waters	Western Australia (including Coastal Waters)
Political
Local Government Areas PSMA 2018	SHIRE OF WYNDHAM-EAST KIMBERLEY
Forests of Australia	Non Forest

Group	Field Name	Original Value	Processed Value


Classification	Scientific name	Pseudogramma polyacantha	Pseudogramma polyacanthus
	Match type		exactMatch
	Phylum id		https://biodiversity.org.au/afd/taxa/065f1da4-53cd-40b8-a396-80fa5c74dedd
	Family id		https://biodiversity.org.au/afd/taxa/d4af9632-e2f9-4391-863d-8d95addd8081
	Taxon concept ID		https://biodiversity.org.au/afd/taxa/8950f239-3bdb-4aca-802d-ce8e004c6c54
	Order		Perciformes
	Taxon rank id		7000
	Species id		https://biodiversity.org.au/afd/taxa/8950f239-3bdb-4aca-802d-ce8e004c6c54
	Genus		Pseudogramma
	Left		45410
	Scientific name authorship		(Bleeker, 1856)
	Taxon rank	Species	species
	Genus id		https://biodiversity.org.au/afd/taxa/8d4842c0-f593-48a4-95db-c2a47336da13
	Name type		SCIENTIFIC
	Vernacular name		Honeycomb Podge
	Order id		https://biodiversity.org.au/afd/taxa/e3fda0ff-4705-4a40-8991-1dfabdadcfae
	Right		45410
	Kingdom		Animalia
	Class id		https://biodiversity.org.au/afd/taxa/83e82cc3-be4e-40e8-9e7a-985737c4f726
	Phylum		Chordata
	Class		Actinopterygii
	Species		Pseudogramma polyacanthus
	Family		Serranidae
	Kingdom id		https://biodiversity.org.au/afd/taxa/4647863b-760d-4b59-aaa1-502c8cdf8d3c
Event	Year		2017
	End day of year		280
	Month		10
	Date precision		DAY
	Start day of year		280
	Day		7
	Event date	2017-10-07	2017-10-07
Occurrence	Associated occurrences		5ebf027b-5d61-44bd-a423-4732ef1a7ef8
	Associated references	http://dx.doi.org/10.1002/edn3.222
	Duplication status		D
	Occurrence status	present	PRESENT
	Basis of record	MaterialSample	MATERIAL_SAMPLE
	Occurrence ID	BIN139
	Duplicate status		ASSOCIATED
Attribution	Data resource		Maximising fish detection with eDNA metabarcoding
	License		CC-BY 3.0 (Au)
	Data Resource ID	dr14581	dr14581
Location	Country		Australia
	Decimal latitude	-14.10443	-14.10443
	Terrestrial	true	true
	Verbatim elevation	Sea level
	Locality	Browse Island North	Browse Island North
	Decimal longitude	123.54690	123.5469
	State province		Western Australia
	Biome		TERRESTRIAL
	Coordinate uncertainty in meters	10	10.0
	Marine	false	false
	Country code		AU
	Geodetic datum		EPSG:4326
	Verbatim depth	Surface